Accès membres

Mot de passe perdu? S'inscrire

01-05-2025 20:11

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Hello, today I have collected a tiny ascomycete g

30-04-2025 18:57

Zoe Vélez Zoe Vélez

Hello Forum, excuse me, do you think these could b

30-04-2025 01:29

David Chapados David Chapados

Hi, I found Dactylellina candida/candidum, recent

25-04-2025 09:33

Josep Torres Josep Torres

Ascomata shaped like deformed black grains, measur

01-05-2025 11:25

Bernard CLESSE Bernard CLESSE

Bonjour à toutes et tous,Pourriez-vous m'aider à

01-05-2025 09:59

Illescas Tomás Illescas Tomás

Bonjour à tous : Je joins des photos macro et mi

29-04-2025 09:13

Louis DENY

Bonjour forumVosges du sud, ballon d'Alsace altitu

28-04-2025 12:51

Thomas Flammer

Substrate: Angelica sylvesrisSpore mass: 8.4 - 11.

12-05-2013 13:31

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Dear mycologists,could someone give me an advice a

18-04-2025 23:16

Robin Pétermann Robin Pétermann

Bonjour, Voici une probable Mollisia, genre que j

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.