
17-09-2025 10:50
Heather MerryleesHi there!I am hoping for any advice on the identif

11-09-2025 16:57
Our revision of Marthamycetales (Leotiomycetes) is

16-09-2025 12:53
Philippe PELLICIERPézizes de 1-4 mm, brun grisâtres, sur les capsu

03-09-2025 12:44
Hi to somebody.I would like to know your opinion o

15-09-2025 14:40

Hello.I'm searching for a digital copy of the seco

14-09-2025 22:16
Philippe PELLICIERApothécies petites jusquà 3 mm, oranges, avec de

13-09-2025 14:01
Thomas Flammerdark brown apothecia, splitIKI-Spores biguttulate

10-09-2025 17:18

Hola, encontre este estiercol de vaca estos apotec

13-09-2025 14:10
Wim de GrootWe found this hymenoscyphus on rubus fruticulosis.

10-09-2025 23:53

Found on Robinia pseudoacasia together with Diapor

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian

Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto