10-05-2026 09:02
Buckwheat PeteHello everybody, ould this be Lachnum subvirgineu
08-05-2026 11:55
Gernot FriebesHi,found on a decorticated Picea abies branch stil
11-05-2016 20:37
Zuzana Sochorová (Egertová)
Hi,this very little ascomycete grew on soil in a m
09-05-2026 07:37
Zuzana Sochorová (Egertová)
Hello,please, could anyone share this paper?Ferná
05-05-2026 22:40
Gernot FriebesHi,I believe this is a Plagiostoma growing on a Sa
06-05-2026 11:25
Castillo Joseba
Me mandan el material seco de Galicia (España) re
06-05-2026 17:23
Thomas Læssøehttps://svampe.databasen.org/observations/10594257
28-04-2026 20:07
Lothar Krieglsteiner
... on twig in the air at standing Ceratonia siliq
04-05-2026 18:13
Stephen Martin Mifsud
ID request for what seems to be a true aquatic fun
Hi -Â I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. Â Â I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Â Â Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is? Â
I could also do LSU sequences....
 The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto