Accès membres

Mot de passe perdu? S'inscrire

01-06-2025 09:37

Charles Aron Charles Aron

Hi All, I found this Octospora growing with liver

05-07-2025 12:38

Åge Oterhals

I found this pyrenomycetous fungi in pine forest o

04-07-2025 20:12

Josep Torres Josep Torres

Hello.A fungus growing on the surface of a trunk o

20-06-2025 08:33

Josep Torres Josep Torres

Hello.Small, blackish, mucronated surface grains s

28-06-2025 16:00

Josep Torres Josep Torres

Hello.A tiny fungus shaped like globose black grai

04-07-2025 12:43

Castillo Joseba Castillo Joseba

me mandan el material seco de Galicia (España) 

03-07-2025 18:40

Castillo Joseba Castillo Joseba

me mandas el material seco de Galicia (España) re

03-07-2025 20:08

Francois Guay Francois Guay

I found this interesting yellowish asco growing on

01-07-2025 23:37

Josep Torres Josep Torres

Hello.A Pleosporal symbiotic organism located and

02-07-2025 17:26

Yanick BOULANGER

BonjourRécolté sur une brindille au fond d'un fo

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto