21-12-2025 09:32
Josep Torres
Hello.A tiny ascomycete found embedded in wood in
22-12-2025 00:47
Patrice TANCHAUDBonsoir, récolte à proximité du milieu dunaire
21-12-2025 21:32
Pol DebaenstHello, Garden, Burgweg 19, Veurne, BelgiumOn 10/1
21-12-2025 21:40
Isabelle CharissouBonjour, j'aimerais connaitre les références de
21-12-2025 21:31
Pol DebaenstHello, Garden, Burgweg 19, Veurne, BelgiumOn 10/1
21-12-2025 21:31
Pol DebaenstHello, Garden, Burgweg 19, Veurne, BelgiumOn 10/1
20-12-2025 23:08
Patrice TANCHAUDBonsoir, récolte sur sol sablonneux dans l'arriÃ
20-12-2025 15:47
Mirek GrycHi.These grew on pine wood that was heavily covere
Hi -Â I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. Â Â I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Â Â Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is? Â
I could also do LSU sequences....
 The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto